make issue (linux ubuntu)

[afafbioinfo]

I think that there is an issue with the directory path! I m getting the following error with make: "/home/user/Downloads/gtfold/gtfold-mfe/include/AdvancedDouble.h:25:10: fatal error: gmp.h: No such file or directory
25 | #include "gmp.h"

Details:

user@user-HP-ZBook-15-G2:~/Downloads/gtfold$ make
/usr/bin/cmake -S/home/user/Downloads/gtfold -B/home/user/Downloads/gtfold --check-build-system CMakeFiles/Makefile.cmake 0
/usr/bin/cmake -E cmake_progress_start /home/user/Downloads/gtfold/CMakeFiles /home/user/Downloads/gtfold/CMakeFiles/progress.marks
make -f CMakeFiles/Makefile2 all
make[1]: Entering directory '/home/user/Downloads/gtfold'
make -f CMakeFiles/gtfold-test.dir/build.make CMakeFiles/gtfold-test.dir/depend
make[2]: Entering directory '/home/user/Downloads/gtfold'
cd /home/user/Downloads/gtfold && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /home/user/Downloads/gtfold /home/user/Downloads/gtfold /home/user/Downloads/gtfold /home/user/Downloads/gtfold /home/user/Downloads/gtfold/CMakeFiles/gtfold-test.dir/DependInfo.cmake --color=
make[2]: Leaving directory '/home/user/Downloads/gtfold'
make -f CMakeFiles/gtfold-test.dir/build.make CMakeFiles/gtfold-test.dir/build
make[2]: Entering directory '/home/user/Downloads/gtfold'
[ 0%] Building CXX object CMakeFiles/gtfold-test.dir/gtfold-mfe/src/AdvancedDouble.cc.o
/usr/bin/c++ -I/home/user/Downloads/gtfold -I/home/user/Downloads/gtfold/gtfold-mfe/include -fPIC -fopenmp -Wall -g -O2 -fvisibility=hidden -fvisibility-inlines-hidden -Igtfold-mfe/include -L/usr/lib -L/usr/local/lib -lpthread -flto -fno-fat-lto-objects -std=gnu++14 -o CMakeFiles/gtfold-test.dir/gtfold-mfe/src/AdvancedDouble.cc.o -c /home/user/Downloads/gtfold/gtfold-mfe/src/AdvancedDouble.cc
In file included from /home/user/Downloads/gtfold/gtfold-mfe/src/AdvancedDouble.cc:1:
/home/user/Downloads/gtfold/gtfold-mfe/include/AdvancedDouble.h:25:10: fatal error: gmp.h: No such file or directory
25 | #include "gmp.h"
| ^~~~~~~
compilation terminated.
make[2]: *** [CMakeFiles/gtfold-test.dir/build.make:66: CMakeFiles/gtfold-test.dir/gtfold-mfe/src/AdvancedDouble.cc.o] Error 1
make[2]: Leaving directory '/home/user/Downloads/gtfold'
make[1]: *** [CMakeFiles/Makefile2:87: CMakeFiles/gtfold-test.dir/all] Error 2
make[1]: Leaving directory '/home/user/Downloads/gtfold'
make: *** [Makefile:133: all] Error 2

[afafbioinfo]

Resolved using :
apt-get install libgmp3-dev

but now I m getting:
collect2: error: ld returned 1 exit status
make[2]: *** [CMakeFiles/gtboltzmann.dir/build.make:432: bin/gtboltzmann] Error 1
make[2]: Leaving directory '/home/user/Downloads/gtfold'
make[1]: *** [CMakeFiles/Makefile2:114: CMakeFiles/gtboltzmann.dir/all] Error 2
make[1]: Leaving directory '/home/user/Downloads/gtfold'
make: *** [Makefile:133: all] Error 2

[maxieds]

@afafbioinfo
I had to do some custom editing of the stock GNU libgomp/libgmp sources for this project (n.b.). I think that you should try running the following just to make sure that you are using the sources as expected:

$ cd Python
$ make clean && make && make test

Does that work?

[afafbioinfo]

Where the "Python" folder is located? I don't see it

[maxieds]

@afafbioinfo
Sorry. I thought you were in the Python bindings repo on the enterprise GitHub. Did you get it working here?

[afafbioinfo]

I was using the wrong repository. Now I downloaded from https://github.gatech.edu/gtDMMB/GTFoldPython. However,the same "ld" error persists with "make".

when trying your suggestion I got another error:

configure: error: cannot find install-sh, install.sh, or shtool in "." "./.." "./../.."
make[1]: *** [Makefile:166: make_runLibDepsConsfigureScripts] Error 1
make[1]: Leaving directory '/home/user/Downloads/GTFoldPython-master/Python'
make: *** [Makefile:235: clean] Error 2

I solved it through:

sudo apt-get install autogen libtool shtool

Now, things seem to work, Just to check:

GTFoldPython-master/gtfold-mfe/src$ gtmfe /home/user/Downloads/GTFoldPython-master/gtfold-mfe/test_data/sequences/5S/d.5.a.D.mobilis.seq

GTfold: A Scalable Multicore Code for RNA Secondary Structure Prediction
(c) 2007-2011 D.A. Bader, C.E. Heitsch, S.C. Harvey
Georgia Institute of Technology

Checking for default datadir '/usr/local/share/gtfold', found.

• Minimum Free Energy: -92.6000 kcal/mol
• MFE runtime: 0.015868 seconds

ACGGUGCCCGACCCGGCCAUAGUGGCCGGGCAACACCCGGUCUCGUUUCGAACCCGGAAGUUAAGCCGGCCACGUCAGAACGGCCGUGAGGUCCGAGAGGCCUCGCAGCCGUUCUGAGCUGGGAUCGGGCACC
..(((((((((((((((....((((((((..(((..((((..(((...)))..))))..)))...)))))))).((((((((((.((((((.((....)))))))).)))))))))))))))).)))))))))

MFE structure saved in .ct format to d.5.a.D.mobili.ct

[ceheitsch]

@maxieds @afafbioinfo Just noting that this is the issue log for the historic gtfold code and not the more recent python version.