From 18f59773744f21e8932c86b86876f5bf958368f5 Mon Sep 17 00:00:00 2001 From: an-altosian Date: Fri, 29 May 2026 18:04:26 +0000 Subject: [PATCH] feat(chemistries): add 10x-flexv2-gex-3p-config-b preset MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Adds a chemistry preset for the 10x Genomics GEM-X Flex v2 sequencing Configuration B (R1=28 / R2=90), as documented in 10x's "Sequencing Requirements for Single Cell Gene Expression Flex" guide. Two fields differ from `10x-flexv2-gex-3p` (Configuration A); all other assets (cell-BC whitelist, sample-BC TSV, probe sets) are byte-identical: - `geometry`: Config A: 1{b[16]u[12]x[0-3]f[TTGCTAGGACCG]s[10]x:}2{r:} Config B: 1{b[16]u[12]x:}2{r[50]f[CCCATATAAGAAAACCTGAATACGCGGTT]s[10]x:} In Config B, R1 stops at 28 bp (cell BC + UMI only — no probe-side anchor), and R2 reads 90 bp from the probe end, so the probe insert, the 29 bp constant `CCCATATAAGAAAACCTGAATACGCGGTT` (the RC of 10x's documented `AACCGCGTATTCAGGTTTTCTTATATGGG`), and the 10 bp sample BC all live on R2. - `sample_bc_list.sample_bc_ori`: Config A: "reverse" (whitelist is RC of what R2 reads) Config B: "forward" (R2 reads the opposite strand, so the whitelist matches the read sequence as-is) Closes #198. --- resources/chemistries.json | 28 ++++++++++++++++++++++++++++ 1 file changed, 28 insertions(+) diff --git a/resources/chemistries.json b/resources/chemistries.json index 9c6ac77..62dcb9a 100644 --- a/resources/chemistries.json +++ b/resources/chemistries.json @@ -196,5 +196,33 @@ "remote_url": "https://umd.box.com/shared/static/z21ofrtnj3t33fb0mti66dc319cgvnuq" } } + }, + "10x-flexv2-gex-3p-config-b": { + "geometry": "1{b[16]u[12]x:}2{r[50]f[CCCATATAAGAAAACCTGAATACGCGGTT]s[10]x:}", + "expected_ori": "both", + "version": "0.1.0", + "plist_name": "dcb018db2e9d7023ac077eb2477b877163fa5dcef7b8e39e0826bc2560c29cf9", + "remote_url": "https://umd.box.com/shared/static/fei8u0tcve2wu73q4qxrskwl3gs7svj1", + "meta": { + "cr_filename": "737K-flex-v2.txt", + "protocol_type": "flex_gex" + }, + "sample_bc_list": { + "plist_name": "5e7ef950ad43c35525e8d923423a7bb1abdce78ca2a8fe4ef9a2d69c5f22830b", + "remote_url": "https://umd.box.com/shared/static/4ogdlgooo1onjkrny9pfbyz4gdt5vktl", + "sample_bc_ori": "forward" + }, + "probe_sets": { + "human": { + "name": "Chromium_Human_Transcriptome_Probe_Set_v2.0.0_GRCh38-2024-A", + "plist_name": "bfa53e2acde140d6bd90c3b21d65c48c5b04e3064adee7402d3016116db04958", + "remote_url": "https://umd.box.com/shared/static/2fd0tda0638wy0fclgh3ywdgul1g53pi" + }, + "mouse": { + "name": "Chromium_Mouse_Transcriptome_Probe_Set_v2.0.0_GRCm39-2024-A", + "plist_name": "8e0ea460bc5a93df85cf5c4f321c62a3e50ad01b5589a8c0c9559bf554f6f276", + "remote_url": "https://umd.box.com/shared/static/z21ofrtnj3t33fb0mti66dc319cgvnuq" + } + } } }